Download Free Creation The Origin Of Life The Future Of Life Book in PDF and EPUB Free Download. You can read online Creation The Origin Of Life The Future Of Life and write the review.

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.
"How scientists are closer than ever to not only uncovering the mystery of how life was created, but to replicating that moment Within the first billion years after this planet formed, a spark of life spontaneously ignited, turning inanimate chemicals into what we now would recognize as a living thing: a cell. Four billion years later, science has catalogued more than a million species. Science writer Adam Rutherford shows how unprecedented advances in our understanding of life have equipped us with the ability to create entirely new life-forms: goats that produce spider silk in their milk, bacteria that excrete diesel, genetic codes that identify and destroy cancer cells. This new synthetic biology is poised to offer radical new solutions to the crises of food shortage, pandemic disease, and climate change. By charting the history of our evolution, questioning what life really is, and identifying the milestones in our understanding of biological processes, Rutherford shows how this frontier of science will kickstart an industrial revolution that will dominate the rest of this century"--Provided by publisher.
We know the universe has a history, but does it also have a story of self-creation to tell? Yes, in Roy R. Gould’s account. He offers a compelling narrative of how the universe—with no instruction other than its own laws—evolved into billions of galaxies and gave rise to life, including humans who have been trying for millennia to comprehend it. Far from being a random accident, the universe is hard at work, extracting order from chaos. Making use of the best current science, Gould turns what many assume to be true about the universe on its head. The cosmos expands inward, not outward. Gravity can drive things apart, not merely together. And the universe seems to defy entropy as it becomes more ordered, rather than the other way around. Strangest of all, the universe is exquisitely hospitable to life, despite its being constructed from undistinguished atoms and a few unexceptional rules of behavior. Universe in Creation explores whether the emergence of life, rather than being a mere cosmic afterthought, may be written into the most basic laws of nature. Offering a fresh take on what brought the world—and us—into being, Gould helps us see the universe as the master of its own creation, not tethered to a singular event but burgeoning as new space and energy continuously stream into existence. It is a very old story, as yet unfinished, with plotlines that twist and churn through infinite space and time.
This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.
What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.
How did the universe begin? Where do galaxies come from? How do stars and planets form? Where do the material particles we are made of come from? How did life begin? Today we have only provisional answers to such questions. But scientific progress will improve these answers dramatically over the next ten years, predicts John Gribbin in this riveting book. He focuses on what we know--or think we know--about ten controversial, unanswered issues in the physical sciences and explains how current cutting-edge research may yield solutions in the very near future. With his trademark facility for engaging readers with or without a scientific background, the author explores ideas concerning the creation of the universe, the possibility of other forms of life, and the fate of the expanding cosmos. He examines "theories of everything,” including grand unified theories and string theory, and he discusses the Big Bang theory, the origin of structure and patterns of matter in the galaxies, and dark mass and dark energy. In the final chapter of the book, Gribbin ponders the future of Earth and the Sun and the possibility that the universe might expand forever.

Best Books

DMCA - Contact